si:ch211-39l18.4

Ensembl ID:
ENSDARG00000008858
ZFIN ID:
ZDB-GENE-070912-293
Human Orthologue:
CYP7B1
Human Description:
cytochrome P450, family 7, subfamily B, polypeptide 1 [Source:HGNC Symbol;Acc:2652]
Mouse Orthologue:
Cyp7b1
Mouse Description:
cytochrome P450, family 7, subfamily b, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:104978]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1217 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008268 Nonsense 300 504 4 6
Genomic Location (Zv9):
Chromosome 2 (position 42248013)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42297477
KASP Assay ID:
554-1126.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTATCCCAGCAGCCTTCTGGTGTCTGTACCACCTCATTTCCTGTCCT[G/T]AAGCCCTGGCAGCAGTTCGAGAGGAGATCACGAACGTGCTCGGAGAGAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link