ptprq

Ensembl ID:
ENSDARG00000008849
ZFIN ID:
ZDB-GENE-050419-183
Description:
Novel protein similar to vertebrate protein tyrosine phosphatase, receptor type, Q (PTPRQ) [Source:U
Human Orthologue:
PTPRQ
Human Description:
protein tyrosine phosphatase, receptor type, Q [Source:HGNC Symbol;Acc:9679]
Mouse Orthologues:
Ptprq, Ptprv
Mouse Descriptions:
protein tyrosine phosphatase, receptor type, Q Gene [Source:MGI Symbol;Acc:MGI:1096349]
protein tyrosine phosphatase, receptor type, V Gene [Source:MGI Symbol;Acc:MGI:108027]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43034 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32184 Nonsense Available for shipment Available now
sa23213 Nonsense Available for shipment Available now
sa23214 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015238   None 136 None 6
ENSDART00000143740 Essential Splice Site 1931 2301 32 43

The following transcripts of ENSDARG00000008849 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 5477030)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6250820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTTTTCTGGCGTTGTTTTTAATTCTGATTATATATGGATCTGTGAAG[T/G]AAGTTGAGTGTGATATACAGTATAATTCAGTTGTGTGTGTGTTTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32184
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015238 Nonsense 74 136 4 6
ENSDART00000143740 Nonsense 2068 2301 38 43
ENSDART00000015238 Nonsense 74 136 4 6
ENSDART00000143740 Nonsense 2068 2301 38 43

The following transcripts of ENSDARG00000008849 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 5486221)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6260011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTAATTGAATCGACCTAAGCTTGTGTTTGATTCTGTGTCTCAGGGCTA[T/A]CTGTGTCCTAATGAGTTTATAGCCACTCAGGGCCCTCTGCCGAGCACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015238 Nonsense 74 136 4 6
ENSDART00000143740 Nonsense 2068 2301 38 43
ENSDART00000015238 Nonsense 74 136 4 6
ENSDART00000143740 Nonsense 2068 2301 38 43

The following transcripts of ENSDARG00000008849 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 5486221)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6260011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTAATTGAATCGACCTAAGCTTGTGTTTGATTCTGTGTCTCAGGGCTA[T/A]CTGTGTCCTAATGAGTTTATAGCCACTCAGGGCCCTCTGCCGAGCACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23214
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015238 Essential Splice Site 118 136 5 6
ENSDART00000143740 Essential Splice Site 2112 2301 39 43

The following transcripts of ENSDARG00000008849 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 5488771)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6262561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACTGAAGCATATATTTGATGTAAATAATAAACAGAATATATGTTTCA[G/A]ATCCGCTGTCATCAGTACTGGCCGGAGGACAATAAACCAGTCACTGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link