hmbsa

Ensembl ID:
ENSDARG00000008840
ZFIN ID:
ZDB-GENE-040426-1375
Description:
hydroxymethylbilane synthase a [Source:RefSeq peptide;Acc:NP_957448]
Human Orthologue:
HMBS
Human Description:
hydroxymethylbilane synthase [Source:HGNC Symbol;Acc:4982]
Mouse Orthologue:
Hmbs
Mouse Description:
hydroxymethylbilane synthase Gene [Source:MGI Symbol;Acc:MGI:96112]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31452 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013431 Nonsense 44 358 3 14
ENSDART00000132664 Nonsense 47 247 3 11
Genomic Location (Zv9):
Chromosome 5 (position 32161586)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29922416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCTCGCATTCAAACTGACAGTGTGGCCGGCACACTAAAACAACTTTA[T/A]CCAGACGTTCATCTAGAGATTGGTAAGCAGGCAATTTTTTTTCATTCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link