chga

Ensembl ID:
ENSDARG00000008829
ZFIN ID:
ZDB-GENE-041010-161
Description:
chromogranin-A [Source:RefSeq peptide;Acc:NP_001006059]
Human Orthologue:
CHGA
Human Description:
chromogranin A (parathyroid secretory protein 1) [Source:HGNC Symbol;Acc:1929]
Mouse Orthologue:
Chga
Mouse Description:
chromogranin A Gene [Source:MGI Symbol;Acc:MGI:88394]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4132 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016014 Nonsense 347 369 8 8
ENSDART00000062078 Nonsense 251 273 7 7
ENSDART00000126919 None None 246 None 6
Genomic Location:
Chromosome 20 (position 27075076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCCCTGATGAGCTTCTTTTGTGTTTTGTTATCAGGATGCTGAGATC[G/T]AGAGTCTGGCTGCCATTGAGTCTGAATTAGARAGCGTGGCTCAGAAGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4sxwx87d