glud1a

Ensembl ID:
ENSDARG00000008816
ZFIN ID:
ZDB-GENE-030114-2
Description:
glutamate dehydrogenase 1a [Source:RefSeq peptide;Acc:NP_997741]
Human Orthologues:
GLUD1, GLUD2
Human Descriptions:
glutamate dehydrogenase 1 [Source:HGNC Symbol;Acc:4335]
glutamate dehydrogenase 2 [Source:HGNC Symbol;Acc:4336]
Mouse Orthologues:
AC160930.1, Glud1
Mouse Descriptions:
glutamate dehydrogenase 1 Gene [Source:MGI Symbol;Acc:MGI:95753]
glutamate dehydrogenase 1, mitochondrial precursor [Source:RefSeq peptide;Acc:NP_032159]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35471 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31925 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016946 Essential Splice Site 386 544 9 13
Genomic Location (Zv9):
Chromosome 13 (position 22826657)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22555995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTAACAAATGTTAAAGAGAATATGAAAATAAAAAACTTGTTTTCATA[G/T]ATCATCGCTGAAGGAGCAAACGGCCCAACTACTCCTGAAGCAGACAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31925
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016946 Essential Splice Site 505 544 12 13
Genomic Location (Zv9):
Chromosome 13 (position 22823459)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22552797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACATTGTGCATTCGGGATTGGCTTACACGATGGAACGATCGGCCAGA[G/T]TAAGTACATGTATAATAATAAGCAGTTTCATTTATCTGTTTATACAGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link