eml2

Ensembl ID:
ENSDARG00000008808
ZFIN ID:
ZDB-GENE-050706-71
Description:
echinoderm microtubule-associated protein-like 2 [Source:RefSeq peptide;Acc:NP_001025406]
Human Orthologue:
EML2
Human Description:
echinoderm microtubule associated protein like 2 [Source:HGNC Symbol;Acc:18035]
Mouse Orthologue:
Eml2
Mouse Description:
echinoderm microtubule associated protein like 2 Gene [Source:MGI Symbol;Acc:MGI:1919455]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42566 Nonsense Mutation detected in F1 DNA During 2018
sa45543 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42565 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32039 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017268 Nonsense 189 833 4 22
Genomic Location (Zv9):
Chromosome 15 (position 28247880)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28966120
GRCz11 15 28898996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGATTCCCGCAGCAGAACCACCTCATCCAGCAGTTCAACATGCGGAAAG[A/T]GAGACAGGTACCTTTTTTATGAATAAAGTGCAGTTAGATTTTTCTTGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45543
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017268 Essential Splice Site 294 833 8 22
Genomic Location (Zv9):
Chromosome 15 (position 28240785)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28959025
GRCz11 15 28891901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGAAATCTTTTCTGACAAGCTCTGATCCTGTCAATGTTCTCTTTGCA[G/A]TTTGGCCATCCATCCAGACATGGTCACTATAGCAACAGGACAAGTTGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017268 Essential Splice Site 318 833 9 22
Genomic Location (Zv9):
Chromosome 15 (position 28239614)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28957854
GRCz11 15 28890730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATACATAAATCCTTAACAGTACACACAACTCAATCGTTGTTTTCCCATC[A/G]GGCTCTGCCACCTCATGTCCGTGTCTGGGACTCTGTCAGTCTGAACACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017268 Nonsense 823 833 22 22
Genomic Location (Zv9):
Chromosome 15 (position 28230522)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28948762
GRCz11 15 28881638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATGTTGCCTTTCTGCATGACGACAGTCATCTTATTTCTACCGGTGGG[A/T]AGGACACCAGCATTCTTCAATGGGTGCTGGCTTAGTCTGATCTGAGCCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link