bokb

Ensembl ID:
ENSDARG00000008807
ZFIN ID:
ZDB-GENE-040426-1346
Description:
Bcl-2-related ovarian killer protein homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q7T381]
Human Orthologue:
BOK
Human Description:
BCL2-related ovarian killer [Source:HGNC Symbol;Acc:1087]
Mouse Orthologue:
Bok
Mouse Description:
BCL2-related ovarian killer protein Gene [Source:MGI Symbol;Acc:MGI:1858494]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13282 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021141 Nonsense 73 211 1 4
ENSDART00000144890 Nonsense 76 214 1 4
Genomic Location:
Chromosome 2 (position 22098435)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGCCAGAACCGCGCGGAGTTCTTGTAGACGTGTCTGTGGTGCTGCTT[A/T]AACTGGGTAAGAGAAGCAGGAGTGAGTGGSAACTGAAAGGAGATCACCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h6pbcg4m