orc3

Ensembl ID:
ENSDARG00000008805
ZFIN IDs:
ZDB-GENE-030131-6247, ZDB-GENE-030131-6247
Description:
origin recognition complex subunit 3 [Source:RefSeq peptide;Acc:NP_997892]
Human Orthologue:
ORC3
Human Description:
origin recognition complex, subunit 3 [Source:HGNC Symbol;Acc:8489]
Mouse Orthologue:
Orc3
Mouse Description:
origin recognition complex, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1354944]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16022 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16022
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047857 Nonsense 33 706 3 20
ENSDART00000112806 Nonsense 39 712 4 21
Genomic Location:
Chromosome 17 (position 49495255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTACTTCTTTCAAYGATCACTATTTTTATTCATTACATGTAGACGAATA[T/G]TTAGTGGAGGCTGACGACGACAGCGGCAGGGATCGATTTAGRATCTGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xsjcsoix