marcksb

Ensembl ID:
ENSDARG00000008803
ZFIN ID:
ZDB-GENE-030131-1921
Description:
myristoylated alanine rich protein kinase C substrate b [Source:RefSeq peptide;Acc:NP_001015060]
Human Orthologue:
MARCKS
Human Description:
myristoylated alanine-rich protein kinase C substrate [Source:HGNC Symbol;Acc:6759]
Mouse Orthologue:
Marcks
Mouse Description:
myristoylated alanine rich protein kinase C substrate Gene [Source:MGI Symbol;Acc:MGI:96907]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39154 Nonsense Mutation detected in F1 DNA During 2016
sa36365 Missense Mutation detected in F1 DNA During 2016
sa6465 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002932 Nonsense 9 232 1 2
Genomic Location:
Chromosome 17 (position 15377007)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTCATTTGATCTGCGATTCTTTGTTGCGTGTGAAAGCATGGGAGCA[C/T]AAATCTCCAAAAACGGAGCAAAAGACGAGACTGCTGCCGAAAAACCCGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002932 Missense 68 232 2 2
Genomic Location:
Chromosome 17 (position 15377967)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGCAGAAGATGTCCAAGCCAATGGAAAGCATGCTGCCGATGGGGAGG[T/C]AAAAGCCGAGGAGGGAAAGGCAGAGGAAGCAGACGCAGAGAAGGCCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002932 Nonsense 112 232 2 2
Genomic Location:
Chromosome 17 (position 15378098)
KASP Assay ID:
554-5296.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGGTGAARACTCCACCAAGACAGAAGAAAGCGCAGCTACTAGYAGC[G/T]AGCCTGCCAAAACCAAAAAGCGATTCTCCTTTAAGAAGCCRTTCAAGCTR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link