scn4aa

Ensembl ID:
ENSDARG00000008797
ZFIN ID:
ZDB-GENE-051201-2
Description:
Sodium channel protein type 4 subunit alpha A [Source:UniProtKB/Swiss-Prot;Acc:Q2XVR3]
Human Orthologue:
SCN4A
Human Description:
sodium channel, voltage-gated, type IV, alpha subunit [Source:HGNC Symbol;Acc:10591]
Mouse Orthologue:
Scn4a
Mouse Description:
sodium channel, voltage-gated, type IV, alpha Gene [Source:MGI Symbol;Acc:MGI:98250]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1270 Essential Splice Site Available for shipment Available now
sa13933 Essential Splice Site Available for shipment Available now
sa31853 Essential Splice Site Available for shipment Available now
sa16761 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010588 Essential Splice Site 500 1829 11 25
ENSDART00000106534 Essential Splice Site 500 1829 11 25
Genomic Location (Zv9):
Chromosome 12 (position 5983421)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4839617
KASP Assay ID:
554-1185.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAAGCTTTACCATATTTAAACATGCTTACTATTTTATGTATCTTTCA[G/A]TTATCAGCAGAAGAGGACCAGAAGTCTCTGAGTTCAAAACACAGCATGCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010588 Essential Splice Site 1396 1829 24 25
ENSDART00000106534 Essential Splice Site 1396 1829 24 25
ENSDART00000010588 Essential Splice Site 1396 1829 24 25
ENSDART00000106534 Essential Splice Site 1396 1829 24 25
Genomic Location (Zv9):
Chromosome 12 (position 5966591)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4856447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGGCTGGAACGTCTTTGATTTTGTTGTAGTCATCCTTTCTATTGCAGG[T/A]AAGTGTAGAATACAGCAGGTTCATTAGAAAGACGTGTGAAAGGACRTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010588 Essential Splice Site 1396 1829 24 25
ENSDART00000106534 Essential Splice Site 1396 1829 24 25
ENSDART00000010588 Essential Splice Site 1396 1829 24 25
ENSDART00000106534 Essential Splice Site 1396 1829 24 25
Genomic Location (Zv9):
Chromosome 12 (position 5966591)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4856447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGGCTGGAACGTCTTTGATTTTGTTGTAGTCATCCTTTCTATTGCAGG[T/C]AAGTGTAGAATACAGCAGGTTCATTAGAAAGACGTGTGAAAGGACATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010588 Nonsense 1472 1829 25 25
ENSDART00000106534 Nonsense 1472 1829 25 25
Genomic Location (Zv9):
Chromosome 12 (position 5965646)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4857392
KASP Assay ID:
2260-4908.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTGATCATGTTCATCTTCTCCATCTTTGGMATGTCTAACTTTGCCTA[T/A]GTGAAAAAGCAGGCAGGCATCGATGACATCTTCAACTTTGAAACATTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link