her5

Ensembl ID:
ENSDARG00000008796
ZFIN ID:
ZDB-GENE-990415-90
Description:
hairy-related 5 [Source:RefSeq peptide;Acc:NP_571152]
Human Orthologue:
HES7
Human Description:
hairy and enhancer of split 7 (Drosophila) [Source:HGNC Symbol;Acc:15977]
Mouse Orthologue:
Hes7
Mouse Description:
hairy and enhancer of split 7 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2135679]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12026 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12026
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023526 Essential Splice Site 9 205 2 3
ENSDART00000145336 Essential Splice Site 31 227 2 3
Genomic Location:
Chromosome 14 (position 31412898)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAATGCTATAGGAATTATGATATTTAAATGCACTATTTTGAATGTTGC[A/T]GGTCCCCAAGCCTCTCATGGAGAAAAGGAGGAGAGATYGCATTAATCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c80mmzis