Q1MT48_DANRE

Ensembl ID:
ENSDARG00000008767
Description:
Novel protein similar to vertebrate transducin-like enhancer family (E(Sp1) homolog Drosophila) [Sou
Human Orthologues:
AC010547.1, AES, TLE2, TLE6
Human Descriptions:
amino-terminal enhancer of split [Source:HGNC Symbol;Acc:307]
transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) [Source:HGNC Symbol;Acc:11838]
transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila) [Source:HGNC Symbol;Acc:30788]
Mouse Orthologues:
Aes, Tle2, Tle6
Mouse Descriptions:
amino-terminal enhancer of split Gene [Source:MGI Symbol;Acc:MGI:95806]
transducin-like enhancer of split 2, homolog of Drosophila E(spl) Gene [Source:MGI Symbol;Acc:MGI:10
transducin-like enhancer of split 6, homolog of Drosophila E(spl) Gene [Source:MGI Symbol;Acc:MGI:21

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43831 Nonsense Mutation detected in F1 DNA During 2017
sa24161 Nonsense Available for shipment Available now
sa10818 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105561 Nonsense 57 774 3 22
Genomic Location (Zv9):
Chromosome 22 (position 22057800)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21711048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTCTCAAGTTGGAGTGTGAGAAGTTGGCCAGTGAGAAAACTGAGATG[C/T]AGCGCCACTATATCATGGTGAGTCTGTTCAGCCCTCATAACGTCAGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105561 Nonsense 77 774 4 22
Genomic Location (Zv9):
Chromosome 22 (position 22039648)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21692896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCACAGTACTACGAGATGTCCTACGGGCTCAACATTGAGATGCACAAA[C/T]AGGTAAGACAGTCCTGTGGGGCGAATTTAGCAAACTGTTTTGCCTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105561 Nonsense 109 774 6 22
Genomic Location (Zv9):
Chromosome 22 (position 22019611)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21672859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTGTGTGTGTTTGTAGCATCAACAGCAGGTTGTTCAGGCGGTGGAG[C/T]GAGCTAAACARGTGACCATGGCAGAGCTCAACGCCATCATAGGGGTGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link