entpd6

Ensembl ID:
ENSDARG00000008757
ZFIN ID:
ZDB-GENE-050417-412
Description:
ectonucleoside triphosphate diphosphohydrolase 6 [Source:RefSeq peptide;Acc:NP_001017862]
Human Orthologue:
ENTPD6
Human Description:
ectonucleoside triphosphate diphosphohydrolase 6 (putative) [Source:HGNC Symbol;Acc:3368]
Mouse Orthologue:
Entpd6
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 6 Gene [Source:MGI Symbol;Acc:MGI:1202295]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18584 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035432 Nonsense 215 442 7 14
Genomic Location:
Chromosome 17 (position 20943420)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACGGTACAGAGACTCCTACAGTAGGTATGCTGGATTTAGGAGGAGGCT[C/A]GACCCAGATCACCTTTGCTCTACAGGATGAAGTGAGCCATGCATACACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgE grass sensitization: A genome-wide meta-analysis of genetic variants associated with allergic rhinitis and grass sensitization and their interaction with birth order. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3lk1fge4