esf1

Ensembl ID:
ENSDARG00000008740
ZFIN ID:
ZDB-GENE-030131-4917
Description:
hypothetical protein LOC326718 [Source:RefSeq peptide;Acc:NP_956039]
Human Orthologue:
ESF1
Human Description:
ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:15898]
Mouse Orthologue:
Esf1
Mouse Description:
ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19593 Nonsense Mutation detected in F1 DNA During 2016
sa38297 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033047 Nonsense 44 517 5 14
ENSDART00000146612 Nonsense 284 757 5 14

The following transcripts of ENSDARG00000008740 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 51724987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTCAGGTCTATCCGTCTGAGTTTGGGAAGGAGAGGATTCACGCTGAA[C/T]AGACTCAGGGTCCACTGGAGCTCAGCAGCCTCCCAGAAAACCCTGACGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033047 Nonsense 356 517 12 14
ENSDART00000146612 Nonsense 596 757 12 14

The following transcripts of ENSDARG00000008740 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 51714196)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACAAAGAGAGCAAGAAGAACAGGAAGAAGGAAGAGGAGCGGACGCCA[G/T]AAGAACAGGAGGAAATGGAAAGGCGGAAGGTGCGTTTCTCTAATCCACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link