esf1

Ensembl ID:
ENSDARG00000008740
ZFIN ID:
ZDB-GENE-030131-4917
Description:
hypothetical protein LOC326718 [Source:RefSeq peptide;Acc:NP_956039]
Human Orthologue:
ESF1
Human Description:
ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:15898]
Mouse Orthologue:
Esf1
Mouse Description:
ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19593 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033047 Nonsense 44 517 5 14
ENSDART00000146612 Nonsense 284 757 5 14

The following transcripts of ENSDARG00000008740 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 51724987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTCAGGTCTATCCGTCTGAGTTTGGGAAGGAGAGGATTCACGCTGAA[C/T]AGACTCAGGGTCCACTGGAGCTCAGCAGCCTCCCAGAAAACCCTGACGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cy6n24y6