atp6ap2

Ensembl ID:
ENSDARG00000008735
ZFIN ID:
ZDB-GENE-040426-1960
Description:
ATPase, H+ transporting, lysosomal accessory protein 2 [Source:RefSeq peptide;Acc:NP_998188]
Human Orthologue:
ATP6AP2
Human Description:
ATPase, H+ transporting, lysosomal accessory protein 2 [Source:HGNC Symbol;Acc:18305]
Mouse Orthologue:
Atp6ap2
Mouse Description:
ATPase, H+ transporting, lysosomal accessory protein 2 Gene [Source:MGI Symbol;Acc:MGI:1917745]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4185 Nonsense Mutation detected in F1 DNA During 2016
sa37444 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016873 Nonsense 250 374 7 9
ENSDART00000125561 Nonsense 262 386 7 9
Genomic Location:
Chromosome 22 (position 11237040)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTTTACTCTCTGGAGCTGGCGGGACTGGAGGAGATTGTTCGCCGCTA[C/A]GGCACAGACTCACCTCAGTACACYGACGCCATYAGGATCCTTACAATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016873 Essential Splice Site 271 374 8 9
ENSDART00000125561 Essential Splice Site 283 386 8 9
Genomic Location:
Chromosome 22 (position 11234791)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATAATATAAACAGTGCTTCTGTTTTTAACGCTTTCGTTCATGTGTGAA[G/A]TTTGCAGATGACGTCTCCAGTGTTTACGGAAACAATGCGGTTGTAGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link