ranbp3

Ensembl ID:
ENSDARG00000008727
ZFIN ID:
ZDB-GENE-040426-1132
Description:
RAN binding protein 3 [Source:RefSeq peptide;Acc:NP_957434]
Human Orthologue:
RANBP3
Human Description:
RAN binding protein 3 [Source:HGNC Symbol;Acc:9850]
Mouse Orthologue:
Ranbp3
Mouse Description:
RAN binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1919060]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16231 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104409 Nonsense 397 509 18 20
ENSDART00000139882 Nonsense 399 511 16 18
Genomic Location:
Chromosome 11 (position 6349328)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGAGCTGTTTGTTTGTGGCTTGCAGTCATGCGGACTCAAGGAAGTCTT[C/T]GAGTGATCCTCAACACTAAGCTCTGGCCTCAGATGCAGGTGGAYAAAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nmcvszvg