prkcba

Ensembl ID:
ENSDARG00000008723
ZFIN ID:
ZDB-GENE-040426-1354
Description:
protein kinase C, beta a [Source:RefSeq peptide;Acc:NP_957323]
Human Orthologue:
PRKCB
Human Description:
protein kinase C, beta [Source:HGNC Symbol;Acc:9395]
Mouse Orthologue:
Prkcb
Mouse Description:
protein kinase C, beta Gene [Source:MGI Symbol;Acc:MGI:97596]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32592 Essential Splice Site Available for shipment Available now
sa31191 Nonsense Available for shipment Available now
sa1978 Nonsense F2 line generated During 2017
sa11204 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006211 Essential Splice Site 129 668 4 17
ENSDART00000137211 Essential Splice Site 129 176 4 6
Genomic Location (Zv9):
Chromosome 1 (position 8108664)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8348469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGGATCTCTACTGTACGGCCTCATACACCAAGGGATGAGATGTTTGA[G/T]TGAGTTCAAACACACACACACACACATTTGCTTTTGTGAATTATGGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006211 Nonsense 442 668 12 17
ENSDART00000137211   None 176 None 6
Genomic Location (Zv9):
Chromosome 1 (position 8128292)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8368097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTGATATAAAATGTAATTTTGTTGTTGTTGTTCACCATCAGGTTCTA[T/A]GCTGGAGAGATTGCCATTGGCCTGTTCTTTCTTCATTCTAAGGGCATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1978
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006211 Nonsense 511 668 14 17
ENSDART00000137211   None 176 None 6
Genomic Location (Zv9):
Chromosome 1 (position 8132108)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8371913
KASP Assay ID:
554-2740.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCCATGAGATATTAAGTATGCTCTTCTGTCCTGCAGATCATTGCATA[T/G]CAGCCGTATGGAAAGTCTGTTGATTGGTGGGCTTATGGAGTTCTCCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006211 Nonsense 528 668 14 17
ENSDART00000137211   None 176 None 6
Genomic Location (Zv9):
Chromosome 1 (position 8132159)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8371964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCGTATGGAAAGTCTGTKGATTGGTGGGCTTATGGAGTTCTCCTGTA[T/A]GAAATGCTGGCMGGACAGGTAAACTGGATGTAAAWTTGTACCACAGTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link