lmo3

Ensembl ID:
ENSDARG00000008720
ZFIN ID:
ZDB-GENE-050522-201
Description:
LIM domain only protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q503U0]
Human Orthologue:
LMO3
Human Description:
LIM domain only 3 (rhombotin-like 2) [Source:HGNC Symbol;Acc:6643]
Mouse Orthologue:
Lmo3
Mouse Description:
LIM domain only 3 Gene [Source:MGI Symbol;Acc:MGI:102810]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20234 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20234
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003583 Nonsense 33 145 2 4
ENSDART00000112860 Nonsense 55 167 2 4
ENSDART00000133767 Nonsense 33 38 2 2
ENSDART00000134362 Nonsense 45 81 3 4
Genomic Location:
Chromosome 4 (position 11685411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCGGAAAATCAAGGACCGCTACCTGCTGAAGGCCCTGGACAAGTACTG[G/A]CACGAAGACTGCCTCAAGTGTGCCTGCTGCGACTGCAGACTCGGCGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7euyub0l