EPAS1 (2 of 2)

Ensembl ID:
ENSDARG00000008697
Description:
endothelial PAS domain protein 1 [Source:HGNC Symbol;Acc:3374]
Human Orthologue:
EPAS1
Human Description:
endothelial PAS domain protein 1 [Source:HGNC Symbol;Acc:3374]
Mouse Orthologue:
Epas1
Mouse Description:
endothelial PAS domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:109169]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18133 Nonsense Available for shipment Available now
sa7697 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024415 Nonsense 53 842 2 16
Genomic Location:
Chromosome 12 (position 27312783)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGGCCCATCAGCTACCATTACCCCACAGCATCAGCTCACACCTGGAC[A/T]AAGCCTCTATCATGAGACTGGCTATCAGCTTCCTGYGCACACGCAAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024415 Nonsense 368 842 9 16
Genomic Location:
Chromosome 12 (position 27339346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTCTCCCTAGACCAGACGGAGGCCTTGTTCAAACCCTACCACACCTA[C/A]GACATGGGCGAAATATTCAGCCAAAACACATCCATTTCCGAACCTCAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pxloo4nm