chrnb2a

Ensembl ID:
ENSDARG00000008674
ZFIN ID:
ZDB-GENE-090312-169
Human Orthologue:
CHRNB4
Human Description:
cholinergic receptor, nicotinic, beta 4 [Source:HGNC Symbol;Acc:1964]
Mouse Orthologue:
Chrnb4
Mouse Description:
cholinergic receptor, nicotinic, beta polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:87892]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12396 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002532 Nonsense 66 490 2 6
ENSDART00000142524 Nonsense 45 469 1 5
Genomic Location:
Chromosome 1 (position 21341103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCAATAAGAGTCAACAGGTCACAATTGGCATCAAAGTCTCTCTCGCA[C/T]ARCTCATTAGTGTGGTAAGTCTCTSTTTCTTTCTTTGTTTCTCTCACTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lung cancer: A susceptibility locus for lung cancer maps to nicotinic acetylcholine receptor subunit genes on 15q25. (View Study)
  • Lung cancer: Familial aggregation of common sequence variants on 15q24-25.1 in lung cancer. (View Study)
  • Nicotine dependence: A variant associated with nicotine dependence, lung cancer and peripheral arterial disease. (View Study)
  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/145wh0cb