chrnb2a

Ensembl ID:
ENSDARG00000008674
ZFIN ID:
ZDB-GENE-090312-169
Human Orthologue:
CHRNB4
Human Description:
cholinergic receptor, nicotinic, beta 4 [Source:HGNC Symbol;Acc:1964]
Mouse Orthologue:
Chrnb4
Mouse Description:
cholinergic receptor, nicotinic, beta polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:87892]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12396 Nonsense Available for shipment Available now
sa39606 Nonsense Mutation detected in F1 DNA During 2016
sa32662 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002532 Nonsense 66 490 2 6
ENSDART00000142524 Nonsense 45 469 1 5
Genomic Location (Zv9):
Chromosome 1 (position 21341103)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21876270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCAATAAGAGTCAACAGGTCACAATTGGCATCAAAGTCTCTCTCGCA[C/T]ARCTCATTAGTGTGGTAAGTCTCTSTTTCTTTCTTTGTTTCTCTCACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002532 Nonsense 75 490 3 6
ENSDART00000142524 Nonsense 54 469 2 5
Genomic Location (Zv9):
Chromosome 1 (position 21337330)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21872497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTATAAACACACCCAATGTTCTATGCTTTTTTACAGAATGAGAGAGAG[C/T]AAATCATGACAACAAATGTCTGGCTGACTCAGGTAAACTCACCTGCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002532 Nonsense 130 490 5 6
ENSDART00000142524 Nonsense 109 469 4 5
Genomic Location (Zv9):
Chromosome 1 (position 21329861)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21865028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGTGTGTATTTTCTTCCCTTACAGTGCAGATGGTGTGTATGAAGTAT[C/A]ATTTTACTGCAATGCAGTCGTCTCCAACACTGGTGACATTTTCTGGCTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lung cancer: A susceptibility locus for lung cancer maps to nicotinic acetylcholine receptor subunit genes on 15q25. (View Study)
  • Lung cancer: Familial aggregation of common sequence variants on 15q24-25.1 in lung cancer. (View Study)
  • Nicotine dependence: A variant associated with nicotine dependence, lung cancer and peripheral arterial disease. (View Study)
  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link