coro1b

Ensembl ID:
ENSDARG00000008660
ZFIN ID:
ZDB-GENE-040123-3
Description:
coronin, actin binding protein, 1B [Source:RefSeq peptide;Acc:NP_001103177]
Human Orthologues:
CORO1A, CORO1B, CORO1C, CORO6
Human Descriptions:
coronin 6 [Source:HGNC Symbol;Acc:21356]
coronin, actin binding protein, 1A [Source:HGNC Symbol;Acc:2252]
coronin, actin binding protein, 1B [Source:HGNC Symbol;Acc:2253]
coronin, actin binding protein, 1C [Source:HGNC Symbol;Acc:2254]
Mouse Orthologues:
Coro1a, Coro1b, Coro1c, Coro6
Mouse Descriptions:
coronin 6 Gene [Source:MGI Symbol;Acc:MGI:2183448]
coronin, actin binding protein 1A Gene [Source:MGI Symbol;Acc:MGI:1345961]
coronin, actin binding protein 1B Gene [Source:MGI Symbol;Acc:MGI:1345963]
coronin, actin binding protein 1C Gene [Source:MGI Symbol;Acc:MGI:1345964]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5762 Nonsense F2 line generated During 2014
sa2372 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5762
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021559 Nonsense 215 499 6 11
ENSDART00000021559 Nonsense 215 499 6 11
Genomic Location:
Chromosome 7 (position 19850385)
KASP Assay ID:
554-3061.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAGATTAGTGATTTTGGTTGTGATTGGATCAATGTCACKCTCAGGTT[C/T]GAGAGAAGGCTCATGAGGGCACCAGGCCGATGAGAGCTGTATTTCTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2372
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021559 Nonsense 215 499 6 11
ENSDART00000021559 Nonsense 215 499 6 11
Genomic Location:
Chromosome 7 (position 19850385)
KASP Assay ID:
554-3061.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAGATTAGTGATTTTGGTTGTGATTGGATCAATGTCACKCTCAGGTT[C/T]GAGAGAAGGCTCATGAGGGCACCAGGCCGATGAGAGCTGTATTTCTGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w5objg2b