coro1b

Ensembl ID:
ENSDARG00000008660
ZFIN ID:
ZDB-GENE-040123-3
Description:
coronin, actin binding protein, 1B [Source:RefSeq peptide;Acc:NP_001103177]
Human Orthologues:
CORO1A, CORO1B, CORO1C, CORO6
Human Descriptions:
coronin 6 [Source:HGNC Symbol;Acc:21356]
coronin, actin binding protein, 1A [Source:HGNC Symbol;Acc:2252]
coronin, actin binding protein, 1B [Source:HGNC Symbol;Acc:2253]
coronin, actin binding protein, 1C [Source:HGNC Symbol;Acc:2254]
Mouse Orthologues:
Coro1a, Coro1b, Coro1c, Coro6
Mouse Descriptions:
coronin 6 Gene [Source:MGI Symbol;Acc:MGI:2183448]
coronin, actin binding protein 1A Gene [Source:MGI Symbol;Acc:MGI:1345961]
coronin, actin binding protein 1B Gene [Source:MGI Symbol;Acc:MGI:1345963]
coronin, actin binding protein 1C Gene [Source:MGI Symbol;Acc:MGI:1345964]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34030 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5762 Nonsense F2 line generated During 2016
sa2372 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa34030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021559 Essential Splice Site 68 499 2 11
Genomic Location (Zv9):
Chromosome 7 (position 19865445)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18398474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTGAGGCTGGAGGAGGTGGAGCCTTTCTTGTGTTGCCACTCGCCAAG[G/A]TTGGCATGCATTCACTTTGCCATATCCAAAAGCAATGTGCAATAAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5762
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021559 Nonsense 215 499 6 11
ENSDART00000021559 Nonsense 215 499 6 11
Genomic Location (Zv9):
Chromosome 7 (position 19850385)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18383414
KASP Assay ID:
554-3061.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAGATTAGTGATTTTGGTTGTGATTGGATCAATGTCACKCTCAGGTT[C/T]GAGAGAAGGCTCATGAGGGCACCAGGCCGATGAGAGCTGTATTTCTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2372
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021559 Nonsense 215 499 6 11
ENSDART00000021559 Nonsense 215 499 6 11
Genomic Location (Zv9):
Chromosome 7 (position 19850385)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18383414
KASP Assay ID:
554-3061.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAGATTAGTGATTTTGGTTGTGATTGGATCAATGTCACKCTCAGGTT[C/T]GAGAGAAGGCTCATGAGGGCACCAGGCCGATGAGAGCTGTATTTCTGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link