NP_998135.1

Ensembl ID:
ENSDARG00000008637
Description:
microsomal triglyceride transfer protein large subunit [Source:RefSeq peptide;Acc:NP_998135]
Human Orthologue:
MTTP
Human Description:
microsomal triglyceride transfer protein [Source:HGNC Symbol;Acc:7467]
Mouse Orthologue:
Mttp
Mouse Description:
microsomal triglyceride transfer protein Gene [Source:MGI Symbol;Acc:MGI:106926]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32615 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11757 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015251 Essential Splice Site 21 738 2 15
Genomic Location (Zv9):
Chromosome 1 (position 11420962)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11437791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCAGAAGATCCAGAAAGTGTCACAGCATGACATTTGTGTGTTTTCTC[A/T]GGTGCTGGACCTCGGCTGGATAACGGCAAACTCTACAGATACAGCTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015251 Nonsense 176 738 5 15
Genomic Location (Zv9):
Chromosome 1 (position 11418659)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11435488
KASP Assay ID:
2259-0303.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTTTGTAATCYATAGGCTGATGCTTCAGGGAAATGTYTGGTWGAGTA[C/A]AAAGTTARCAAACWTCAGGTGATCCGCACAAAACACTTGGAAACTTGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link