si:ch211-30i2.1

Ensembl ID:
ENSDARG00000008575
ZFIN IDs:
ZDB-GENE-070702-1, ZDB-GENE-070702-1, ZDB-GENE-070702-1, ZDB-GENE-070702-1, ZDB-GENE-081028-72
Description:
Novel protein similar to H.sapiens LYST, lysosomal trafficking regulator (LYST) [Source:UniProtKB/Tr
Human Orthologue:
LYST
Human Description:
lysosomal trafficking regulator [Source:HGNC Symbol;Acc:1968]
Mouse Orthologue:
Lyst
Mouse Description:
lysosomal trafficking regulator Gene [Source:MGI Symbol;Acc:MGI:107448]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17821 Essential Splice Site Available for shipment Available now
sa14050 Nonsense Available for shipment Available now
sa14595 Nonsense Available for shipment Available now
sa4537 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa17821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099439 Essential Splice Site 121 1862 4 17
ENSDART00000136165 Essential Splice Site 121 1216 5 8
ENSDART00000136516   None 250 None 4
ENSDART00000143148   None 522 None 9
ENSDART00000143262   None 747 None 15
ENSDART00000148057   None 431 None 9
Genomic Location (Zv9):
Chromosome 13 (position 50984077)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49695174
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGAAGAAWTCTGTTTAAATCCTGAATTAAYCTCTCAAACCTTTTACTC[A/C]GGAGTTGACCTGTCGGGAAGARCTGCTTAMGCTCTTATTGTCTCTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14050
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099439 Nonsense 332 1862 5 17
ENSDART00000136165 Nonsense 332 1216 6 8
ENSDART00000136516   None 250 None 4
ENSDART00000143148   None 522 None 9
ENSDART00000143262   None 747 None 15
ENSDART00000148057   None 431 None 9
Genomic Location (Zv9):
Chromosome 13 (position 50982884)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49693981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGAAAAGGTCTGCAAATTTGACAKGACCATCAATCATAACCCAGGCT[T/A]GGCGGTCAGCGTTGTTCCCACCCTCACAGAGATACTCACTGACTTTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099439 Nonsense 1539 1862 12 17
ENSDART00000136165   None 1216 None 8
ENSDART00000136516   None 250 None 4
ENSDART00000143148   None 522 None 9
ENSDART00000143262   None 747 None 15
ENSDART00000148057   None 431 None 9
Genomic Location (Zv9):
Chromosome 13 (position 50955757)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49666854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGATTCAGCGCATCGCTGTGGGTGCGGGCTGGGAAAGATGAAGACGKA[C/T]GATCTAAGAAGGGTGAGAAGAACRTTAWTAGCTTTATGTACTTACYCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4537
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099439   None 1862 None 17
ENSDART00000136165   None 1216 None 8
ENSDART00000136516 Essential Splice Site 62 250 2 4
ENSDART00000143148   None 522 None 9
ENSDART00000143262   None 747 None 15
ENSDART00000148057   None 431 None 9
Genomic Location (Zv9):
Chromosome 13 (position 50917146)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49628243
KASP Assay ID:
554-3548.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCTCTCGGTCATGCTTGGATACACAAACCTGTCCATRTATTCCCGTA[G/A]CTCCTGGACGCCTACTTCAGCCGCGCTCAGAAAGAGCAGAAGGAGAARTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link