brap

Ensembl ID:
ENSDARG00000008560
ZFIN ID:
ZDB-GENE-040718-168
Description:
BRCA1-associated protein [Source:RefSeq peptide;Acc:NP_001002466]
Human Orthologue:
BRAP
Human Description:
BRCA1 associated protein [Source:HGNC Symbol;Acc:1099]
Mouse Orthologue:
Brap
Mouse Description:
BRCA1 associated protein Gene [Source:MGI Symbol;Acc:MGI:1919649]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21638 Nonsense Mutation detected in F1 DNA During 2014
sa6156 Nonsense Mutation detected in F1 DNA During 2014
sa17070 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109148 Nonsense 105 578 3 12

The following transcripts of ENSDARG00000008560 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 3350268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACGTCAGCCAGACAGATGTGAACATGACACCCGACTCTCCCTCCAAA[C/T]AGCTGCCGGATCAGATCTCCTTTTTCAGTGGAAACCCATCGGTGGAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109148 Nonsense 316 578 8 12

The following transcripts of ENSDARG00000008560 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 3361532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATYAATTATTAATATTTGTTCTYYTAGAATCTGTGGATCTGTCTCATCTG[C/A]GGTCACATCGGCTGCGGRCGTTACGTCAGTCGTCATGCTTACAAGCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109148 Splice Site, Nonsense 392 578 10 12

The following transcripts of ENSDARG00000008560 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 3363624)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTAGATACTCTTCTCTCTCATATTTGAACRCTTTTCTGTYTCCAGTA[T/A]TCATATTTATTAACCAGTCAGCTGGAGTCTCAGCGCATWTACTGGGAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Drinking behavior: Confirmation of ALDH2 as a Major locus of drinking behavior and of its variants regulating multiple metabolic phenotypes in a Japanese population. (View Study)
  • Esophageal cancer: Functional variants in ADH1B and ALDH2 coupled with alcohol and smoking synergistically enhance esophageal cancer risk. (View Study)
  • Hypothyroidism: Novel associations for hypothyroidism include known autoimmune risk loci. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m6j812y3