si:ch211-159p3.3

Ensembl ID:
ENSDARG00000008548
ZFIN IDs:
ZDB-GENE-050809-38, ZDB-GENE-050809-38, ZDB-GENE-050809-38, ZDB-GENE-050809-38, ZDB-GENE-070912-125
Description:
Rho GTPase activating protein 12a [Source:RefSeq peptide;Acc:NP_001119879]
Human Orthologue:
ARHGAP12
Human Description:
Rho GTPase activating protein 12 [Source:HGNC Symbol;Acc:16348]
Mouse Orthologue:
Arhgap12
Mouse Description:
Rho GTPase activating protein 12 Gene [Source:MGI Symbol;Acc:MGI:1922665]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33007 Essential Splice Site Available for shipment Available now
sa25119 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19855 Nonsense Available for shipment Available now
sa18172 Essential Splice Site Available for shipment Available now
sa17967 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050403 Essential Splice Site 445 831 6 17
ENSDART00000135836   None 488 None 10
ENSDART00000138620 Essential Splice Site 240 261 6 7
ENSDART00000142804 Essential Splice Site 445 831 7 18
Genomic Location (Zv9):
Chromosome 2 (position 43841044)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43926545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCCGCGCCGCAAAACCACCTTGCGCTCTCACCCTTATTTTCCACAAG[T/G]CAGTGTTGCCTCGCCACTATATTCCAGCCGCCAATCACATCGGATGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050403 Essential Splice Site 466 831 None 17
ENSDART00000135836 Essential Splice Site 370 488 None 10
ENSDART00000138620   261 261 None 7
ENSDART00000142804 Essential Splice Site 466 831 None 18
Genomic Location (Zv9):
Chromosome 2 (position 43845521)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43931022
KASP Assay ID:
554-7400.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCCACTTTAAACATGACTAAAATCACTGAACATGGAAAGAAAGTCCGG[T/A]AAGTAGAACCAATCAGGTAGAGAGAGAGCTAGAAATGCTTCCATCTACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050403 Nonsense 509 831 9 17
ENSDART00000135836 Nonsense 413 488 8 10
ENSDART00000138620   None 261 None 7
ENSDART00000142804 Nonsense 509 831 10 18
Genomic Location (Zv9):
Chromosome 2 (position 43845820)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43931321
KASP Assay ID:
2259-2538.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGTTTGGAAGAGACCAGAAGAGTTCAGTGGAGTACAGTGTGGATCTC[A/T]AAGGAGGGTCGGTGGACTGGGCGTCTAAAGACAAATCCAGCAAGAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050403 Essential Splice Site 635 831 12 17
ENSDART00000135836   None 488 None 10
ENSDART00000138620   None 261 None 7
ENSDART00000142804 Essential Splice Site 635 831 13 18
Genomic Location (Zv9):
Chromosome 2 (position 43853096)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43938597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGGCAGACCTACTTTACAAGCTGTCAAAGACAAAGGCTACATTAAAGG[T/C]ATTACACRCACCTATAAGCAGACACAGTKTTATGTTTAAAATTCAGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17967
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050403 Essential Splice Site 668 831 13 17
ENSDART00000135836   None 488 None 10
ENSDART00000138620   None 261 None 7
ENSDART00000142804 Essential Splice Site 668 831 14 18
Genomic Location (Zv9):
Chromosome 2 (position 43853286)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43938787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTCCCCCGCTTTGTCTGGTTGTGCATTGAGCAAGTGGAGAAGAACGG[T/A]ACTTCTCAATCNTTTTTTTTGTTTTAGTAACTTTACAGGTKTTTAATATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link