glcci1

Ensembl ID:
ENSDARG00000008503
ZFIN ID:
ZDB-GENE-031010-41
Description:
glucocorticoid-induced transcript 1 protein [Source:RefSeq peptide;Acc:NP_001073419]
Human Orthologue:
GLCCI1
Human Description:
glucocorticoid induced transcript 1 [Source:HGNC Symbol;Acc:18713]
Mouse Orthologue:
Glcci1
Mouse Description:
glucocorticoid induced transcript 1 Gene [Source:MGI Symbol;Acc:MGI:2179717]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6557 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1717 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036854 Essential Splice Site 220 531 3 8
Genomic Location:
Chromosome 19 (position 25865075)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACACCAGCGCTCAGCGTCCTGGGGCAGCTCTGACCATCTTAAAGAGG[T/A]ACACAAACACACACACAAATACACACACTTCCACCAACAGCACAAAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036854 Nonsense 411 531 7 8
Genomic Location:
Chromosome 19 (position 25849448)
KASP Assay ID:
554-1663.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCTCCTCTTCCTAAGTTCGCTTCATCTCCAAAGCCCAACAACAGTTA[C/A]ATGTTCAAACGGGAGCCTCCAGAGGGCTGTGAGAAGATCAAAGTCTTTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bgymgqg2