myl6

Ensembl ID:
ENSDARG00000008494
ZFIN ID:
ZDB-GENE-041010-28
Description:
myosin, light chain 6, alkali, smooth muscle and non-muscle [Source:RefSeq peptide;Acc:NP_001005955
Human Orthologues:
MYL6, MYL6B
Human Descriptions:
myosin, light chain 6, alkali, smooth muscle and non-muscle [Source:HGNC Symbol;Acc:7587]
myosin, light chain 6B, alkali, smooth muscle and non-muscle [Source:HGNC Symbol;Acc:29823]
Mouse Orthologues:
AC170752.1, Gm8894, Myl6b
Mouse Descriptions:
myosin light polypeptide 6 [Source:RefSeq peptide;Acc:NP_034990]
myosin, light polypeptide 6B Gene [Source:MGI Symbol;Acc:MGI:1917789]
predicted gene 8894 Gene [Source:MGI Symbol;Acc:MGI:3643084]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5378 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077662 Essential Splice Site 142 151 5 7
ENSDART00000130613 Missense 143 164 5 5
ENSDART00000135631 Essential Splice Site 142 151 5 6
ENSDART00000141611 Essential Splice Site 94 103 4 5

The following transcripts of ENSDARG00000008494 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 39814496)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGCTCTTAGCAGGACACGAGGACGCTAACGGTTGCATCAATTATGAAG[G/A]TACAATAACACACAAGGTCTTTTTCTTCRCTGAAGATCAAGACCACAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tmche3rt