Q6NY49_DANRE

Ensembl ID:
ENSDARG00000008491
Description:
LOC407663 protein [Source:UniProtKB/TrEMBL;Acc:Q6NY49]
Human Orthologues:
RDH11, RDH12
Human Descriptions:
retinol dehydrogenase 11 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:17964]
retinol dehydrogenase 12 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:19977]
Mouse Orthologues:
Rdh11, Rdh12
Mouse Descriptions:
retinol dehydrogenase 11 Gene [Source:MGI Symbol;Acc:MGI:102581]
retinol dehydrogenase 12 Gene [Source:MGI Symbol;Acc:MGI:1925224]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34093 Nonsense Available for shipment Available now
sa20973 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002075 Nonsense 148 331 4 7
Genomic Location (Zv9):
Chromosome 7 (position 31520101)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29912443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATTACATTTATTTTTCTGCCAACAGGGGTAATGATGTGCCCAAAGTG[G/A]CATACAGATGAAGGTTTTGAGATGCAGATTGGAGTAAACCACTTGGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20973
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002075 Essential Splice Site 234 331 5 7
Genomic Location (Zv9):
Chromosome 7 (position 31523613)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29915955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTGGCTAATGTTCTGTTTACCCGTGAACTAGCTATCAAGCTAAGAGG[T/A]AAACCATAAACAAATGTTCTTCACTCTAATAGTTTAAAAAAAAAAACATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link