ltv1

Ensembl ID:
ENSDARG00000008490
ZFIN ID:
ZDB-GENE-040712-1
Description:
Protein LTV1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5U3J8]
Human Orthologue:
LTV1
Human Description:
LTV1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:21173]
Mouse Orthologue:
Ltv1
Mouse Description:
LTV1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2447810]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32780 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010543 Essential Splice Site 369 473 9 11
Genomic Location (Zv9):
Chromosome 1 (position 54435686)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53209189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATACTCCAACCTCTACAACAGGCCCAAACTGATCCAGGACTCTCCGAAG[G/A]TGAAGAAACCCGCCTCGCACTGAGCCAGTGATTTCATTTTATTTTTATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link