dmd

Ensembl ID:
ENSDARG00000008487
ZFIN ID:
ZDB-GENE-010426-1
Description:
dystrophin [Source:RefSeq peptide;Acc:NP_571860]
Human Orthologue:
DMD
Human Description:
dystrophin [Source:HGNC Symbol;Acc:2928]
Mouse Orthologue:
Dmd
Mouse Description:
dystrophin, muscular dystrophy Gene [Source:MGI Symbol;Acc:MGI:94909]

Alleles

There are 21 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31194 Nonsense Available for shipment Available now
sa32610 Nonsense Available for shipment Available now
sa25537 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12459 Nonsense Available for shipment Available now
sa32609 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16997 Nonsense Available for shipment Available now
sa39559 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8798 Nonsense Mutation detected in F1 DNA During 2017
sa18688 Nonsense Mutation detected in F1 DNA During 2017
sa19441 Nonsense Available for shipment Available now
sa11033 Nonsense Available for shipment Available now
sa32608 Nonsense Mutation detected in F1 DNA During 2017
sa39558 Nonsense Mutation detected in F1 DNA During 2017
sa19440 Nonsense Available for shipment Available now
sa25536 Nonsense Mutation detected in F1 DNA During 2017
sa32607 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32606 Nonsense Mutation detected in F1 DNA During 2017
sa239 Nonsense Confirmed mutation in F2 line During 2017
sa19439 Nonsense Available for shipment Available now
sa13095 Essential Splice Site Available for shipment Available now
sa19438 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 160 3633 6 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10204856)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10337194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCATGGCGGACTTACAGCAGACCAACAGCGAAAAGATCCTGTTAAGCT[G/A]GGTCAGGCAGTCCCTCAAAAACTACCAAGACGTCAACGTGGTCAACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32610
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 288 3633 8 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10200507)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10332845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTCGAGCCGCAGTGACCAAGGAGGAGCACGTCCTCTATCAAACCCAA[C/T]AGCGGTACTCTCAGCAGGTCAGACAAACACACACTCATAGATAAACACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25537
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Essential Splice Site 338 3633 9 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10199982)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10332320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCTACGTCAAGACACCTGAACAGCAGAGGAAGTTCCTCATCGCACAGG[T/C]TTGTTTCTGTTGACTGCTCCACCATGTTGCCAAGCAGTGCAGCTGTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 548 3633 13 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10184899)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10317237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGTGGTGGTTRTAGATGAGAATAGYGGGGATGGCGCCACCGCAGCCT[T/A]GGAGGAAAAGCTGCAGGTACGTTTTATTTTTATTTTGTAATGTTAATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Essential Splice Site 553 3633 13 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10184881)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10317219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAATAGTGGGGATGGCGCCACCGCAGCCTTGGAGGAAAAGCTGCAGG[T/A]ACGTTTTATTTTTATTTTGTAATGTTAATAGAAAAATCCACTTTTTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 658 3633 16 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10177482)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10309820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTCGTCCAGGATCTGCTGACTAACATCAAGAGCAAAGAGGCCGCTGGG[A/T]AGCTGGAAGCAAAGCTGGAGAGGTTTGCTCAGCGCTGGGACAAATTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Essential Splice Site 782 3633 18 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10171962)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10304300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTCCCGTAAAGAAGGCAGTGTGGCAGATCTCTATGAAAAAGTGCTGG[T/A]AAGACCACATGAACACATTTTATAGTGATTCACCTGTATTACACAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 1261 3633 27 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 1261 3633 27 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10142269)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10274607
KASP Assay ID:
2259-0261.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGCTCCTCCCGCGGCCCATGATGCCCTGAAGGCAGAACTGGATGTTT[T/A]GACTTCTAACTACCAGCGCCTGTGCAGCCGACTCGAWGGAAAATGCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 1261 3633 27 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 1261 3633 27 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10142269)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10274607
KASP Assay ID:
2259-0261.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGCTCCTCCCGCGGCCCATGATGCCCTGAAGGCAGAACTGGATGTTT[T/A]GACTTCTAACTACCAGCGCCTGTGCAGCCGACTCGATGGAAAATGCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 1295 3633 28 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10141856)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10274194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTAGGAAGTGTGGGCATGCTGGTGTGAGCTGCTGTCTTATTTGGAGT[T/A]GGAGAATGCCTGGATGGACCTACTTGAAAAGAAACTTGATGAAACGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 1520 3633 32 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10134039)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10266377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGGGAGTGCTGAGTATTCGCAGTGTGGAGCAGGAAGTGGTGCAGTCA[C/T]AGCTTGAGCAGTGCATGGTGGGTAATGTAGAATGTTTAGATACATTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 1571 3633 33 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10133316)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10265654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAACCCAAGGAGTTAGACGACAGGCTGACGGCCCTCAAACTCGCTTA[C/A]AATGATTTGGGTTCACAGGTATGAGAAAACAAGGCTTGAGTGTAAAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 1646 3633 35 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10131890)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10264228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTTCCTACCCAGGCAGCGCAGGAGGACACTGAGCATCATAAGCCA[C/T]AGTTGAAACTGGTGAGGGAGTTGGCAGGGACCCTGAAGGGTTTACTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 1776 3633 37 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10128445)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10260783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGAACACAGGGGAACATTGTAAAGCTCAAGTGAAACCAAAGCTTGAA[C/T]AGCTTAACCAACGTTTTGACATTGTTGCAAGAAGGATTTTAATGGGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 1801 3633 38 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10126857)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10259195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTTGATCATATTTTCTTCCAGGCCTCCTCCCAAGAGTTAGACGAGTA[C/A]CACAGACAGGCTAATATATGGCTCCAGGTGCTGGACGAGGAGATTAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Essential Splice Site 1876 3633 39 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10124567)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10256905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTTCGAGAGAAACACAACCTTCTCCATGACAGATATGACACTCTAAAG[G/A]TAATTGCTGAGCTGGTGACACATGTCAAGTACATGCTTTATTGGAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013   None 1096 None 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 2438 3633 51 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10101632)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10233970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGATCACATGGTTCAGACCCAGAGAGTAATGGTGGGGGATCTGGAC[G/T]AGATCAACGAAATGACGGTCAAACTCAAGGTCAGATTTTGATAGCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa239
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 Nonsense 96 1096 2 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 2584 3633 54 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10097715)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10230053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCAGATGAATGTCACTAATGAGCTGGCAAACAAACTACTGACTCTTTA[T/A]GCAGACGACGACACAAGCAAAGTGAAACAAATGACCGAGAGCATGAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 Nonsense 289 1096 5 26
ENSDART00000009886   None 594 None 17
ENSDART00000102903 Nonsense 2777 3633 57 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10087703)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10220041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGAGAAGCAGAAGCCAGTAGGGGGCGACGTGCCGACCGTTCACCAA[C/T]AACTCCTCACGCACAAGGTGAGCCCAGGACAAATCCAATTCAAGCCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 Essential Splice Site 564 1096 None 26
ENSDART00000009886 Essential Splice Site 53 594 None 17
ENSDART00000102903 Essential Splice Site 3052 3633 None 78
ENSDART00000126518 Essential Splice Site 53 362 None 11
ENSDART00000141052   None 206 None 6
ENSDART00000148305   None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10059093)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10191431
KASP Assay ID:
2259-0251.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATACAGGACGGCAATGAAGCTCAGACGAATGCAGAAAGCCCTCTGTTG[T/A]AAGWCCACACCACTTACGTTTTATTGTTGGYTTTCTAAACGGCTAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 Nonsense 998 1096 22 26
ENSDART00000009886 Nonsense 496 594 13 17
ENSDART00000102903 Nonsense 3508 3633 75 78
ENSDART00000126518   None 362 None 11
ENSDART00000141052 Nonsense 106 206 2 6
ENSDART00000148305 Nonsense 51 149 1 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10024750)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10157088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGCCAAACTACTGCGGCAACACAAGGGACGATTGGAGGCAAGAATG[C/T]AAATCCTGGAGGATCACAACAAGCAGCTGGAATCGCAGCTTACACGCCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link