trmt61a

Ensembl ID:
ENSDARG00000008480
ZFIN ID:
ZDB-GENE-040718-5
Description:
tRNA (adenine-N(1)-)-methyltransferase catalytic subunit TRMT61A [Source:RefSeq peptide;Acc:NP_0010
Human Orthologue:
TRMT61A
Human Description:
tRNA methyltransferase 61 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:23790]
Mouse Orthologue:
Trmt61a
Mouse Description:
tRNA methyltransferase 61 homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2443487]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14256 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003517 Essential Splice Site 111 305 None 4
ENSDART00000130832 Essential Splice Site 111 315 None 4
ENSDART00000135960 Essential Splice Site 111 179 None 3
Genomic Location:
Chromosome 13 (position 15659057)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACACTGATGCTGGAGCTCAAACCAGGCTCTGTTGTGTGCGAGTCAGG[T/C]AAGATGATGTGCTGTGTTCCTGCTGGTCTTTAGTGGCCCATTTTCACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zf5evnnh