LOC568371

Ensembl ID:
ENSDARG00000008473
Human Orthologue:
ASB14
Human Description:
ankyrin repeat and SOCS box-containing 14 [Source:HGNC Symbol;Acc:19766]
Mouse Orthologue:
Asb14
Mouse Description:
ankyrin repeat and SOCS box-containing 14 Gene [Source:MGI Symbol;Acc:MGI:2655107]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17581 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019008 Essential Splice Site 531 589 10 10
Genomic Location:
Chromosome 11 (position 43677259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAWACCATTAATTGTGACCTAAACTACAGTGTTACCCATTTGTCTCCACA[G/A]AGAATGTGCGATGTCTGCAGCATCTCTGTCGGCTGAAGATCAGGGCTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jp72boyo