anapc5

Ensembl ID:
ENSDARG00000008461
ZFIN ID:
ZDB-GENE-030131-1574
Description:
anaphase-promoting complex subunit 5 [Source:RefSeq peptide;Acc:NP_955916]
Human Orthologue:
ANAPC5
Human Description:
anaphase promoting complex subunit 5 [Source:HGNC Symbol;Acc:15713]
Mouse Orthologues:
Anapc5, Gm10482
Mouse Descriptions:
anaphase-promoting complex subunit 5 Gene [Source:MGI Symbol;Acc:MGI:1929722]
predicted gene 10482 Gene [Source:MGI Symbol;Acc:MGI:3644444]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16935 Nonsense Available for shipment Available now
sa5499 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16935
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026592 Nonsense 147 760 5 18
Genomic Location:
Chromosome 8 (position 42152958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCGTCAGATGCTGCTTGCCTRCAAWAAACTGTCCTTCAGTCAGGTGTA[T/A]AAGYTGTAYAAGTCTCTGCAGCAGTTCWGCCATCGTGGAAATCAGCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026592 Nonsense 465 760 12 18
Genomic Location:
Chromosome 8 (position 42147669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCTTGTTGAATATGAACAGTCTGGAGCCGGTTAACYTCAGTGTRCAG[C/T]AGAACAACACTGAGGCCTTTGCTGTTGCTCTCTGCCATCTAGCAGAACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3s918p1g