
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
anapc5
- Ensembl ID:
- ENSDARG00000008461
- ZFIN ID:
- ZDB-GENE-030131-1574
- Description:
- anaphase-promoting complex subunit 5 [Source:RefSeq peptide;Acc:NP_955916]
- Human Orthologue:
- ANAPC5
- Human Description:
- anaphase promoting complex subunit 5 [Source:HGNC Symbol;Acc:15713]
- Mouse Orthologues:
- Anapc5, Gm10482
- Mouse Descriptions:
- anaphase-promoting complex subunit 5 Gene [Source:MGI Symbol;Acc:MGI:1929722]
- predicted gene 10482 Gene [Source:MGI Symbol;Acc:MGI:3644444]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16935 | Nonsense | Available for shipment | Available now |
sa34461 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16935
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026592 | Nonsense | 147 | 760 | 5 | 18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 42152958)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 40167731 GRCz11 8 40201505 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGCGTCAGATGCTGCTTGCCTRCAAWAAACTGTCCTTCAGTCAGGTGTA[T/A]AAGYTGTAYAAGTCTCTGCAGCAGTTCWGCCATCGTGGAAATCAGCCTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34461
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026592 | Nonsense | 737 | 760 | 18 | 18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 42138151)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 40152924 GRCz11 8 40186698 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCTACAAGCTCGCCTGCATCAGACTCTCGGCAACATCTCTCAACGCAAC[A/T]GATGTGCCATGCTCTTCCGCCTGCTGGATCAGGAGCTGCCATCATCCCGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: