anapc5

Ensembl ID:
ENSDARG00000008461
ZFIN ID:
ZDB-GENE-030131-1574
Description:
anaphase-promoting complex subunit 5 [Source:RefSeq peptide;Acc:NP_955916]
Human Orthologue:
ANAPC5
Human Description:
anaphase promoting complex subunit 5 [Source:HGNC Symbol;Acc:15713]
Mouse Orthologues:
Anapc5, Gm10482
Mouse Descriptions:
anaphase-promoting complex subunit 5 Gene [Source:MGI Symbol;Acc:MGI:1929722]
predicted gene 10482 Gene [Source:MGI Symbol;Acc:MGI:3644444]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16935 Nonsense Available for shipment Available now
sa5499 Nonsense Mutation detected in F1 DNA During 2016
sa34461 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16935
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026592 Nonsense 147 760 5 18
Genomic Location:
Chromosome 8 (position 42152958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCGTCAGATGCTGCTTGCCTRCAAWAAACTGTCCTTCAGTCAGGTGTA[T/A]AAGYTGTAYAAGTCTCTGCAGCAGTTCWGCCATCGTGGAAATCAGCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026592 Nonsense 465 760 12 18
Genomic Location:
Chromosome 8 (position 42147669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCTTGTTGAATATGAACAGTCTGGAGCCGGTTAACYTCAGTGTRCAG[C/T]AGAACAACACTGAGGCCTTTGCTGTTGCTCTCTGCCATCTAGCAGAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026592 Nonsense 737 760 18 18
Genomic Location:
Chromosome 8 (position 42138151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTACAAGCTCGCCTGCATCAGACTCTCGGCAACATCTCTCAACGCAAC[A/T]GATGTGCCATGCTCTTCCGCCTGCTGGATCAGGAGCTGCCATCATCCCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link