anapc5

Ensembl ID:: ENSDARG00000008461
ZFIN ID:: ZDB-GENE-030131-1574
Description:: anaphase-promoting complex subunit 5 [Source:RefSeq peptide;Acc:NP_955916]
Human Orthologue:: ANAPC5
Human Description:: anaphase promoting complex subunit 5 [Source:HGNC Symbol;Acc:15713]
Mouse Orthologues:: Anapc5, Gm10482
Mouse Descriptions:: anaphase-promoting complex subunit 5 Gene [Source:MGI Symbol;Acc:MGI:1929722]; predicted gene 10482 Gene [Source:MGI Symbol;Acc:MGI:3644444]

Alleles

There are 2 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa16935	Nonsense	Available for shipment	Available now
sa5499	Nonsense	Mutation detected in F1 DNA	During 2014

Mutation Details

Allele Name:: sa16935
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000026592	Nonsense	147	760	5	18

Genomic Location:: Chromosome 8 (position 42152958)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: ATGCGTCAGATGCTGCTTGCCTRCAAWAAACTGTCCTTCAGTCAGGTGTA[T/A]AAGYTGTAYAAGTCTCTGCAGCAGTTCWGCCATCGTGGAAATCAGCCTGA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa5499
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2014.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000026592	Nonsense	465	760	12	18

Genomic Location:: Chromosome 8 (position 42147669)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: AGCTCTTGTTGAATATGAACAGTCTGGAGCCGGTTAACYTCAGTGTRCAG[C/T]AGAACAACACTGAGGCCTTTGCTGTTGCTCTCTGCCATCTAGCAGAACTT
Associated Phenotype:: Not determined

OMIM

OMIM information for ANAPC5

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: