faah2a

Ensembl ID:
ENSDARG00000008457
ZFIN ID:
ZDB-GENE-040718-453
Description:
Fatty-acid amide hydrolase 2-A [Source:UniProtKB/Swiss-Prot;Acc:Q6DH69]
Human Orthologue:
FAAH2
Human Description:
fatty acid amide hydrolase 2 [Source:HGNC Symbol;Acc:26440]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19538 Nonsense Available for shipment Available now
sa39653 Nonsense Mutation detected in F1 DNA During 2016
sa30803 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037553 Nonsense 21 532 1 11
Genomic Location (Zv9):
Chromosome 1 (position 40629914)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39519323
KASP Assay ID:
2259-0863.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGTTCGAGCGTTTTTTGGGTCGCCTGCTTAGAGCTGTGGTGTGGATTT[T/A]ATTCGCCGCTTTTAAGTTATTTGCACCTCAGCAGCGACATGGAGTTTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037553 Nonsense 195 532 4 11
ENSDART00000037553 Nonsense 195 532 4 11
Genomic Location (Zv9):
Chromosome 1 (position 40634699)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39524108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGGCTCGAGTCTCACAACCACCTTTATGGCATCACTAACAACCCCTA[T/A]GACTTCGAAAGAATTGTAGGCGGAAGCTCAGGTCATTGAAACATGCATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037553 Nonsense 195 532 4 11
ENSDART00000037553 Nonsense 195 532 4 11
Genomic Location (Zv9):
Chromosome 1 (position 40634699)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39524108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGGCTCGAGTCTCACAACCACCTTTATGGCATCACTAACAACCCCTA[T/A]GACTTCGAAAGAATTGTAGGCGGAAGCTCAGGTCATTGAAACATGCATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link