pcolce2a

Ensembl ID:
ENSDARG00000008450
ZFIN ID:
ZDB-GENE-070705-25
Description:
Novel protein similar to vertebrate procollagen C-endopeptidase enhancer 2 (PCOLCE2) [Source:UniProt
Human Orthologue:
PCOLCE2
Human Description:
procollagen C-endopeptidase enhancer 2 [Source:HGNC Symbol;Acc:8739]
Mouse Orthologue:
Pcolce2
Mouse Description:
procollagen C-endopeptidase enhancer 2 Gene [Source:MGI Symbol;Acc:MGI:1923727]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19674 Nonsense Available for shipment Available now
sa30591 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040111 Nonsense 73 423 2 9

The following transcripts of ENSDARG00000008450 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 7816203)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8233857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATTGGGAGTCAAGGGTACCCCGCTGTTTACCCACCCAACAACAAATG[T/A]GTGTGGAGAATTACAGTAAGGACAGATGTGTGATTTCTTTAAATGACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040111 Nonsense 359 423 8 9

The following transcripts of ENSDARG00000008450 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 7827480)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8245134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACTTTTTCCATCATGCACCTTTATAAAGAAGGAAATTTAGCCATCCAA[C/T]AAGCTGGGAAAACCATGAGCACCAAAGTTACGGTCCTCTGCAAACAATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link