phospho1

Ensembl ID:
ENSDARG00000008403
ZFIN ID:
ZDB-GENE-040801-198
Description:
Probable phosphatase phospho1 [Source:UniProtKB/Swiss-Prot;Acc:Q6DBV4]
Human Orthologue:
PHOSPHO1
Human Description:
phosphatase, orphan 1 [Source:HGNC Symbol;Acc:16815]
Mouse Orthologue:
Phospho1
Mouse Description:
phosphatase, orphan 1 Gene [Source:MGI Symbol;Acc:MGI:2447348]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40023 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055834 Nonsense 142 279 3 3
Genomic Location (Zv9):
Chromosome 3 (position 15414122)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15659723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAAGTGGTTTGTGTGTCTGACGCCAATACAGTCTTCATAGAGACGTG[G/A]CTGCAGTACATGGGCTTCCAGCCGCTGTTTCTGCGCATTTTCACCAACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link