cacna1c

Ensembl ID:
ENSDARG00000008398
ZFIN ID:
ZDB-GENE-020129-1
Description:
voltage-dependent L-type calcium channel subunit alpha-1C [Source:RefSeq peptide;Acc:NP_571975]
Human Orthologue:
CACNA1C
Human Description:
calcium channel, voltage-dependent, L type, alpha 1C subunit [Source:HGNC Symbol;Acc:1390]
Mouse Orthologue:
Cacna1c
Mouse Description:
calcium channel, voltage-dependent, L type, alpha 1C subunit Gene [Source:MGI Symbol;Acc:MGI:103013]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10930 Nonsense Available for shipment Available now
sa6050 Essential Splice Site Confirmed mutation in F2 line During 2014
sa6943 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15296 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016938 Nonsense 291 2195 7 49
ENSDART00000028856 Nonsense 292 2168 6 47
ENSDART00000132909 Nonsense 292 2196 6 48
Genomic Location:
Chromosome 4 (position 19371735)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCCCCTCCTTCACATCGCTCTGCTCRTTCTGTTCGTCATCATCATTTA[T/A]GCCATCRTCGGCCTCGAGCTCTTCATGGGCAAGATGCATAGAACCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6050
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016938 Essential Splice Site 316 2195 7 49
ENSDART00000028856 Essential Splice Site 317 2168 6 47
ENSDART00000132909 Essential Splice Site 317 2196 6 48
Genomic Location:
Chromosome 4 (position 19371810)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGGCAAGATGCATAGAACCTGTTTCTTCTATAAAGATGGACACAAAGG[T/G]CAGGACTTCAKCTTTTGCTTCTCCCTTGAACTAGTCATTGACCCTGKTGT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Entity Quality Tag
Larval:Day 4
ZFS:0000036
eye
ZFA:0000107

decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
gut
ZFA:0000112

edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
head
ZFA:0001114

decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
locomotory behavior
GO:0007626

quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
pericardium
ZFA:0000054

edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
sensory perception of sound
GO:0007605

absent
PATO:0000462
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
skeletal muscle
ZFA:0005277

degenerate
PATO:0000639
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
whole organism
ZFA:0001094
anterior/posterior axis
BSPO:0000013
decreased length
PATO:0000574
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
yolk
ZFA:0000084

necrotic
PATO:0000647
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
8:55706885-55707600 55706885 -1 4.03 × 10-151 -2.5 0 rho ENSDARG00000002193
6:269178-269600 269178 -1 2.35 × 10-103 -2.8 -2 pde6h ENSDARG00000070439
11:26408301-26408960 26408960 1 2.05 × 10-92 -3.2 -2 opn1sw2 ENSDARG00000017274
8:29301377-29302200 29301377 -1 2.28 × 10-54 3.2 0 cebpb ENSDARG00000042725
8:26078534-26079300 26078534 -1 1.52 × 10-53 -2.8 -1 gnat2 ENSDARG00000042529

Mutation Details

Allele Name:
sa6943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016938 Essential Splice Site 569 2195 13 49
ENSDART00000028856 Essential Splice Site 570 2168 12 47
ENSDART00000132909 Essential Splice Site 570 2196 12 48
Genomic Location:
Chromosome 4 (position 19382628)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCCTCAGAGCATCACCAGCAGCCGGAGTGGCTCACCAATGTACAAGG[T/C]AMTCTACATTACAARGCTGTACATWTATCAMCATACTAATACTGACACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15296
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016938 Essential Splice Site 1510 2195 37 49
ENSDART00000028856 Essential Splice Site 1483 2168 35 47
ENSDART00000132909 Essential Splice Site 1511 2196 36 48
Genomic Location:
Chromosome 4 (position 19400632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGCCATCTTCTACTTTGTTAGCTTTTATATGCTTTGCGCCTTYCTGG[T/C]GAGYTGACATCGATATRTCTTTCCAGTAAGCAACTTTGTTATTGTATATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vvg1wmaw