ftr24

Ensembl ID:
ENSDARG00000008396
ZFIN ID:
ZDB-GENE-050731-2
Description:
Novel protein (Zgc:114036) [Source:UniProtKB/TrEMBL;Acc:B0S6R8]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16001 Nonsense Available for shipment Available now
sa19876 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16001
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056306 Nonsense 45 558 2 7
Genomic Location:
Chromosome 2 (position 48035911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCTGCGGACACAGTTATTGCATGAACTGTATTACAGACTACTGGAAT[C/T]AAAATGATCAGAGGAGAGTTTACAGCTGCCCTCAGTGCAGAGAAACCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056306 Nonsense 557 558 7 7
Genomic Location:
Chromosome 2 (position 48030512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCTATCCTGGGTTTTGGATAGATCCAGGCTCAAGGCTTAAAATTTGT[A/T]GACTTTAATGATCCTATACCAGACTAGATTTGGGACATAAACCAGAAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5tonwvel