mmp14b

Ensembl ID:
ENSDARG00000008388
ZFIN ID:
ZDB-GENE-030901-2
Description:
matrix metalloproteinase 14b (membrane-inserted) [Source:RefSeq peptide;Acc:NP_919395]
Human Orthologue:
MMP14
Human Description:
matrix metallopeptidase 14 (membrane-inserted) [Source:HGNC Symbol;Acc:7160]
Mouse Orthologue:
Mmp14
Mouse Description:
matrix metallopeptidase 14 (membrane-inserted) Gene [Source:MGI Symbol;Acc:MGI:101900]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39891 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5721 Nonsense F2 line generated During 2016
sa2034 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa39891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044264 Essential Splice Site 332 621 6 10
Genomic Location:
Chromosome 2 (position 37880755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATTTTGACACCATTGGCATTTTCAGAGGAGAAATGTTTGTGTTTAAG[G/A]TACTGATGGAGTATGTGCTGCATTATTTTTGGAATAATGACTAGGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5721
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044264 Nonsense 335 621 7 10
ENSDART00000044264 Nonsense 335 621 7 10
Genomic Location:
Chromosome 2 (position 37880849)
KASP Assay ID:
554-2622.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGATTGTTTGTTCATTATGGTTCCTGTCTCTGTGTTTTAGGGTAAGTG[G/A]TTCTGGCGTGTTCGWAATAATCAAGTTATGGAAAACTACCCCATGCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2034
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044264 Nonsense 335 621 7 10
ENSDART00000044264 Nonsense 335 621 7 10
Genomic Location:
Chromosome 2 (position 37880849)
KASP Assay ID:
554-2622.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGATTGTTTGTTCATTATGGTTCCTGTCTCTGTGTTTTAGGGTAAGTG[G/A]TTCTGGCGTGTTCGWAATAATCAAGTTATGGAAAACTACCCCATGCCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link