mmp14b

Ensembl ID:
ENSDARG00000008388
ZFIN ID:
ZDB-GENE-030901-2
Description:
matrix metalloproteinase 14b (membrane-inserted) [Source:RefSeq peptide;Acc:NP_919395]
Human Orthologue:
MMP14
Human Description:
matrix metallopeptidase 14 (membrane-inserted) [Source:HGNC Symbol;Acc:7160]
Mouse Orthologue:
Mmp14
Mouse Description:
matrix metallopeptidase 14 (membrane-inserted) Gene [Source:MGI Symbol;Acc:MGI:101900]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5721 Nonsense F2 line generated During 2014
sa2034 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5721
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044264 Nonsense 335 621 7 10
ENSDART00000044264 Nonsense 335 621 7 10
Genomic Location:
Chromosome 2 (position 37880849)
KASP Assay ID:
554-2622.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGATTGTTTGTTCATTATGGTTCCTGTCTCTGTGTTTTAGGGTAAGTG[G/A]TTCTGGCGTGTTCGWAATAATCAAGTTATGGAAAACTACCCCATGCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2034
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044264 Nonsense 335 621 7 10
ENSDART00000044264 Nonsense 335 621 7 10
Genomic Location:
Chromosome 2 (position 37880849)
KASP Assay ID:
554-2622.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGATTGTTTGTTCATTATGGTTCCTGTCTCTGTGTTTTAGGGTAAGTG[G/A]TTCTGGCGTGTTCGWAATAATCAAGTTATGGAAAACTACCCCATGCCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nk8fsz0p