hdac6

Ensembl ID:
ENSDARG00000008384
ZFIN ID:
ZDB-GENE-030131-3232
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A7YT55]
Human Orthologue:
HDAC6
Human Description:
histone deacetylase 6 [Source:HGNC Symbol;Acc:14064]
Mouse Orthologue:
Hdac6
Mouse Description:
histone deacetylase 6 Gene [Source:MGI Symbol;Acc:MGI:1333752]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18529 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104830 Essential Splice Site 814 928 18 21
Genomic Location:
Chromosome 8 (position 7937765)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCAGKCAGTCTTAGAGCGCRTCTTTGGAGCACAAGCCACCGATGTGG[T/G]AAGCTGTTACAGTCATGGATTGAAGTTCAATTTGTTCTGAATGCACAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gdo0wc9e