hdac6

Ensembl ID:
ENSDARG00000008384
ZFIN ID:
ZDB-GENE-030131-3232
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A7YT55]
Human Orthologue:
HDAC6
Human Description:
histone deacetylase 6 [Source:HGNC Symbol;Acc:14064]
Mouse Orthologue:
Hdac6
Mouse Description:
histone deacetylase 6 Gene [Source:MGI Symbol;Acc:MGI:1333752]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34294 Nonsense Mutation detected in F1 DNA During 2016
sa34293 Nonsense Mutation detected in F1 DNA During 2016
sa18529 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104830 Nonsense 70 928 2 21
Genomic Location (Zv9):
Chromosome 8 (position 7969580)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7414217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATCTGGCCATAGCAGCACGATATGCTCAGAAACGACACAGGGTTCAA[C/T]GGTGAGTCTGCTTTCTTTCTTTACCATGATATGCTTAGATACACATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104830 Nonsense 665 928 17 21
Genomic Location (Zv9):
Chromosome 8 (position 7939808)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7384445
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGAATCTCTTCGTTTGTCTCTACCTTCACCTAAACCAAAAGGCAAATG[T/A]ACACCGGGGGGGAAGGGTAAGAAGTCTCCTCGCCAATCCACCCCTTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104830 Essential Splice Site 814 928 18 21
Genomic Location (Zv9):
Chromosome 8 (position 7937765)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7382402
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCAGKCAGTCTTAGAGCGCRTCTTTGGAGCACAAGCCACCGATGTGG[T/G]AAGCTGTTACAGTCATGGATTGAAGTTCAATTTGTTCTGAATGCACAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link