brd7

Ensembl ID:
ENSDARG00000008380
ZFIN ID:
ZDB-GENE-040426-2687
Description:
bromodomain containing 7 [Source:RefSeq peptide;Acc:NP_998531]
Human Orthologue:
BRD7
Human Description:
bromodomain containing 7 [Source:HGNC Symbol;Acc:14310]
Mouse Orthologue:
Brd7
Mouse Description:
bromodomain containing 7 Gene [Source:MGI Symbol;Acc:MGI:1349766]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11332 Nonsense Available for shipment Available now
sa7076 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100379 Nonsense 55 407 2 11
ENSDART00000143300 Nonsense 55 628 2 17
Genomic Location:
Chromosome 7 (position 39136118)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCCGGCCTCGAGACTGCATATGAWGACCAGGTAGATTACGACAAACAC[A/T]AAGATAAGAAANNNAAGAAGAAAAAGAAGGACGAAAAGGACAAAGCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100379 None None 407 None 11
ENSDART00000143300 Nonsense 597 628 16 17
Genomic Location:
Chromosome 7 (position 39147141)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGACCAGTCAGGTGACCCCAGCTGATGTGTGCAGTGTTTATGGAATC[A/T]GAAAGGCCATGGGGGTCTCGCTTCCCAATGCACAGGATCCATTCATACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u5u3xgx5