LOC560542

Ensembl ID:
ENSDARG00000008377
Human Orthologue:
EPN2
Human Description:
epsin 2 [Source:HGNC Symbol;Acc:18639]
Mouse Orthologue:
Epn2
Mouse Description:
epsin 2 Gene [Source:MGI Symbol;Acc:MGI:1333766]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33264 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40131 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20093 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055176 Essential Splice Site 198 590 1 8
Genomic Location:
Chromosome 3 (position 39659364)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGGAGGAGTACGGCAAGTCTGAGGGGTCACCTGCATCATATCATGGAT[G/A]TAAGTAGATGTTTCTTTAGCTTGTCAACTTGCCAAACGGAATTGTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055176 Essential Splice Site 314 590 4 8
Genomic Location:
Chromosome 3 (position 39673103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCTGCAGCAGCAGCAGGCCCCACCTCAGACCCCTGGCAGTCCTATGG[T/G]AAACACAGACACACACACAAGGAATTTGCTTTCAGTTGGCCGTTATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055176 Essential Splice Site 400 590 6 8
Genomic Location:
Chromosome 3 (position 39678311)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAGGACTTCTCTGAGTTTGACAGCATTCGCTCCTCAGCACTGACAGG[T/C]AAACGATGACTACCACGACTTCGTTTTTCAAATTAGAAAATGGGTCATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link