accn2b

Ensembl ID:
ENSDARG00000008329
ZFIN ID:
ZDB-GENE-040513-2
Description:
Amiloride-sensitive cation channel 2-B, neuronal [Source:UniProtKB/Swiss-Prot;Acc:Q708S7]
Human Orthologue:
ACCN2
Human Description:
amiloride-sensitive cation channel 2, neuronal [Source:HGNC Symbol;Acc:100]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21190 Nonsense Mutation detected in F1 DNA During 2014
sa14670 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004588 Nonsense 9 501 2 11
ENSDART00000105541 Nonsense 9 501 1 10
Genomic Location:
Chromosome 8 (position 7539368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTTCCCAGTGGAGGAACAAGTCAATGAAGACATCAGTGATGGATCTT[A/T]AAGTGGAACCAATGGACATTGATTTCGACCAGCCTCCGCCTCTCCAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004588 Nonsense 64 501 2 11
ENSDART00000105541 Nonsense 64 501 1 10
Genomic Location:
Chromosome 8 (position 7539535)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGCCTCTGGGTGGTGTTTTTCCTCAGCTCTTTGACTTTTCTCATGTA[C/A]GTCTGCATTGATCGCATTCAGTTCTACCTGGAATATCCTCATGTCACCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/60dntoom