LOC100332642

Ensembl ID:
ENSDARG00000008322
Human Orthologue:
AMBRA1
Human Description:
autophagy/beclin-1 regulator 1 [Source:HGNC Symbol;Acc:25990]
Mouse Orthologue:
Ambra1
Mouse Description:
autophagy/beclin 1 regulator 1 Gene [Source:MGI Symbol;Acc:MGI:2443564]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11767 Essential Splice Site Available for shipment Available now
sa21027 Nonsense Available for shipment Available now
sa10425 Nonsense Available for shipment Available now
sa2402 Nonsense Mutation detected in F1 DNA During 2014
sa14147 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098033 Essential Splice Site 64 1194 2 18
Genomic Location:
Chromosome 7 (position 40747375)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCAGACAGTCCCCGCTCAACCTYTCTGCTAGCCTTTAGTCCGGACAGG[T/C]AAGACCACTTTGATTACACTTTCATACTCAGGCTTGRCCAAAGGAAWCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098033 Nonsense 406 1194 6 18
Genomic Location:
Chromosome 7 (position 40744987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACTGGACAGTCAGTGGACTTAATGGACAAAGCAGTAGTATGACTCCA[C/T]AAAGAACTGGCGCTTCCTCTGTTAGCCTTCTTTCTGTCCTGCGACAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098033 Nonsense 421 1194 6 18
ENSDART00000098033 Nonsense 421 1194 6 18
Genomic Location:
Chromosome 7 (position 40744942)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCACAAAGAACTGGCGCTTCCTCTGTTAGCCTTCTTTCTGTCCTGCGA[C/T]AGCAAGAGACTTCCTTTCAATCACCTGTTTACACTTCTGCTAKTGATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098033 Nonsense 492 1194 6 18
Genomic Location:
Chromosome 7 (position 40744729)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGGATTATGAGGGAACGCAGGACACGGTCCAGCCTCTTGATGGCAGC[A/T]GACAGGACCAGCAGACTCAGGAAATGCTCAACAACAACATGGACCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098033 Nonsense 1054 1194 16 18
Genomic Location:
Chromosome 7 (position 40673404)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATCCTGCTGTGGGATGTGTCATGTTTTGCAGGAGCAGCAGGACTGAT[C/T]GACGGTCACGCAGAGACATAGGCCTGATGAATGGAGTTGGTCTGCAGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j4ulflz0