rdh5

Ensembl ID:
ENSDARG00000008306
ZFIN ID:
ZDB-GENE-050208-411
Description:
retinol dehydrogenase 5 [Source:RefSeq peptide;Acc:NP_001025272]
Human Orthologue:
RDH5
Human Description:
retinol dehydrogenase 5 (11-cis/9-cis) [Source:HGNC Symbol;Acc:9940]
Mouse Orthologue:
Rdh5
Mouse Description:
retinol dehydrogenase 5 Gene [Source:MGI Symbol;Acc:MGI:1201412]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37435 Essential Splice Site Mutation detected in F1 DNA During 2017
sa3191 Nonsense F2 line generated During 2017
sa5966 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002348 Essential Splice Site None 328 1 6
ENSDART00000128590   None 344 None 5
Genomic Location (Zv9):
Chromosome 22 (position 10231927)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10092095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTTACGCATGTTAGCGCCCTGTGACTACATAATCTAAGAGAAACACG[T/C]GAGTCAATATTGTTCAATAAGCCTCCAAAGAGCACGTTACGTCACTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3191
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002348   None 328 2 6
ENSDART00000128590 Nonsense 3 344 1 5
Genomic Location (Zv9):
Chromosome 22 (position 10228067)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10088235
KASP Assay ID:
554-3324.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGTGTTTTTCTTTTTCNNTTTTTTACGTCACTGGCATTCTACCAAAAGG[C/T]AATTGTTTACAAAACATCTCCGCAGAGCCACTCAGGAGGTAGAAGCGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002348 Nonsense 302 328 6 6
ENSDART00000128590 Nonsense 318 344 5 5
Genomic Location (Zv9):
Chromosome 22 (position 10223548)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10083716
KASP Assay ID:
554-3854.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCACCCAAGAACTCGCTACAGCGCTGGCTGGGATGCCAAGTTTTTGTG[G/A]ATCCCCTTGTCTTATATGCCTGCTTGCTTTGTCGATATTGCCTTGAAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link