fam114a1

Ensembl ID:
ENSDARG00000008287
ZFIN ID:
ZDB-GENE-070410-52
Description:
family with sequence similarity 114, member A1 [Source:RefSeq peptide;Acc:NP_001082947]
Human Orthologue:
FAM114A1
Human Description:
family with sequence similarity 114, member A1 [Source:HGNC Symbol;Acc:25087]
Mouse Orthologue:
Fam114a1
Mouse Description:
family with sequence similarity 114, member A1 Gene [Source:MGI Symbol;Acc:MGI:1915553]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24838 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11826 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082063 Essential Splice Site 188 546 5 13
ENSDART00000147228 None None 254 None 6

The following transcripts of ENSDARG00000008287 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 17328276)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACCATCATATTTATGTTCATACTAATTCATCCTTCTTGCTTTTTTTA[G/A]GGAAAGTCAGTAATAACTGGAGGTCTTGATGCTTTGGAGTTCATTGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082063 Essential Splice Site 354 546 8 13
ENSDART00000147228 Essential Splice Site 121 254 3 6

The following transcripts of ENSDARG00000008287 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 17323266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTACTCTTTGAGCTCCAYGTTGCCGCAACTCCAGACAAGCTGAACAAA[G/A]TATGGTCACACTTTYAAACACATTCATGTATATCCACTGTYAATGCAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rwiut7bt