fam114a1

Ensembl ID:
ENSDARG00000008287
ZFIN ID:
ZDB-GENE-070410-52
Description:
family with sequence similarity 114, member A1 [Source:RefSeq peptide;Acc:NP_001082947]
Human Orthologue:
FAM114A1
Human Description:
family with sequence similarity 114, member A1 [Source:HGNC Symbol;Acc:25087]
Mouse Orthologue:
Fam114a1
Mouse Description:
family with sequence similarity 114, member A1 Gene [Source:MGI Symbol;Acc:MGI:1915553]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24838 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39588 Nonsense Mutation detected in F1 DNA During 2016
sa11826 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082063 Essential Splice Site 188 546 5 13
ENSDART00000147228   None 254 None 6

The following transcripts of ENSDARG00000008287 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 17328276)
KASP Assay ID:
554-7812.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACCATCATATTTATGTTCATACTAATTCATCCTTCTTGCTTTTTTTA[G/A]GGAAAGTCAGTAATAACTGGAGGTCTTGATGCTTTGGAGTTCATTGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39588
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082063 Nonsense 330 546 8 13
ENSDART00000147228 Nonsense 97 254 3 6

The following transcripts of ENSDARG00000008287 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 17323341)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTTGGGCATAAAATTCATGTTATCTGTGTGTTTCAGCTGCTGATGGA[G/T]AGGAGTTTGTCAGTGTTCTTACCGAACTACTCTTTGAGCTCCACGTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082063 Essential Splice Site 354 546 8 13
ENSDART00000147228 Essential Splice Site 121 254 3 6

The following transcripts of ENSDARG00000008287 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 17323266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTACTCTTTGAGCTCCAYGTTGCCGCAACTCCAGACAAGCTGAACAAA[G/A]TATGGTCACACTTTYAAACACATTCATGTATATCCACTGTYAATGCAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link