si:ch211-254d18.2

Ensembl ID:
ENSDARG00000008279
ZFIN ID:
ZDB-GENE-090312-186
Description:
dual specificity mitogen-activated protein kinase kinase 7 [Source:RefSeq peptide;Acc:NP_001177235]
Human Orthologue:
MAP2K7
Human Description:
mitogen-activated protein kinase kinase 7 [Source:HGNC Symbol;Acc:6847]
Mouse Orthologue:
Map2k7
Mouse Description:
mitogen-activated protein kinase kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1346871]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19558 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048191 Nonsense 123 438 4 12
ENSDART00000148086 Nonsense 114 428 3 11
Genomic Location (Zv9):
Chromosome 1 (position 46319601)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45157113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGAAATCGATCAGAAGTTGCAGGAAATCATGAAACAAACCGGATATT[T/A]GAAGATTGATGGACAGGTGAGTGTTTATTCAATTTTTAATATGCCCCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link