rcor2

Ensembl ID:
ENSDARG00000008278
ZFIN ID:
ZDB-GENE-040426-1812
Description:
REST corepressor 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6P116]
Human Orthologue:
RCOR2
Human Description:
REST corepressor 2 [Source:HGNC Symbol;Acc:27455]
Mouse Orthologue:
Rcor2
Mouse Description:
REST corepressor 2 Gene [Source:MGI Symbol;Acc:MGI:1859854]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34063 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002961 Essential Splice Site 101 536 6 13

The following transcripts of ENSDARG00000008278 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 26152482)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24714234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAGATGGAGGCATTGATCACTTATACTATCCTCCTGCGTTATATCAAC[A/T]GGCTCTTGGCATGCTTCTGTGGCACAAGCATGATGTGGAGAAGTCACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link