mfsd4b

Ensembl ID:
ENSDARG00000008263
ZFIN ID:
ZDB-GENE-060810-38
Description:
Major facilitator superfamily domain-containing protein 4-B [Source:UniProtKB/Swiss-Prot;Acc:A9JTG4]
Human Orthologue:
MFSD4
Human Description:
major facilitator superfamily domain containing 4 [Source:HGNC Symbol;Acc:25433]
Mouse Orthologue:
Mfsd4
Mouse Description:
major facilitator superfamily domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2442786]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24289 Nonsense Mutation detected in F1 DNA During 2016
sa1664 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010270 Nonsense 88 536 2 10
Genomic Location (Zv9):
Chromosome 23 (position 18275706)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18178645
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGTTTTGTTCCTCAGGTTGTTCAGCGCTCTGCTCGCTCTCTTCCTCT[C/A]GTCCCTCATCATCTCTGTGGTTTTTTCCATCATCCCACTTTGCTATAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010270 Nonsense 482 536 9 10
Genomic Location (Zv9):
Chromosome 23 (position 18285058)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18187997
KASP Assay ID:
554-1611.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTCGGTTTCATCTTCCTCCTGAGTGTGATCCTGAGCAACCACTTCCAC[A/T]GAAAAATCACAGGTACAAAAACAACAACAATGTACTCCCATTCATTACAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link