mfsd4b

Ensembl ID:
ENSDARG00000008263
ZFIN ID:
ZDB-GENE-060810-38
Description:
Major facilitator superfamily domain-containing protein 4-B [Source:UniProtKB/Swiss-Prot;Acc:A9JTG4]
Human Orthologue:
MFSD4
Human Description:
major facilitator superfamily domain containing 4 [Source:HGNC Symbol;Acc:25433]
Mouse Orthologue:
Mfsd4
Mouse Description:
major facilitator superfamily domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2442786]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4220 Nonsense Mutation detected in F1 DNA During 2014
sa24289 Nonsense Mutation detected in F1 DNA During 2014
sa8005 Nonsense Mutation detected in F1 DNA During 2014
sa1664 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010270 Nonsense 43 536 1 10
Genomic Location:
Chromosome 23 (position 18273999)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCTTTGGACTGAGCATTGCTTTTCTGGGGCCTACCATCCTGGATCTG[A/T]AATGCCGGACMGGCTCCACGCTGCAAGAGATCACCTGGGTTTTCTTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010270 Nonsense 88 536 2 10
Genomic Location:
Chromosome 23 (position 18275706)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGTTTTGTTCCTCAGGTTGTTCAGCGCTCTGCTCGCTCTCTTCCTCT[C/A]GTCCCTCATCATCTCTGTGGTTTTTTCCATCATCCCACTTTGCTATAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010270 Nonsense 285 536 5 10
Genomic Location:
Chromosome 23 (position 18280759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCCCAAAGTTTTTCTTCACTCTGGACATGGAAACATCTTCAGCTGCTG[T/A]ACGGATGGTGCTCTGCGTGGGTTACCCGTCACCTTCTTTCTCWTCYACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010270 Nonsense 482 536 9 10
Genomic Location:
Chromosome 23 (position 18285058)
KASP Assay ID:
554-1611.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTCGGTTTCATCTTCCTCCTGAGTGTGATCCTGAGCAACCACTTCCAC[A/T]GAAAAATCACAGGTACAAAAACAACAACAATGTACTCCCATTCATTACAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a3pcx9c6