cnot6

Ensembl ID:
ENSDARG00000008255
ZFIN ID:
ZDB-GENE-030131-2768
Description:
CCR4-NOT transcription complex, subunit 6 [Source:RefSeq peptide;Acc:NP_997825]
Human Orthologue:
CNOT6
Human Description:
CCR4-NOT transcription complex, subunit 6 [Source:HGNC Symbol;Acc:14099]
Mouse Orthologue:
Cnot6
Mouse Description:
CCR4-NOT transcription complex, subunit 6 Gene [Source:MGI Symbol;Acc:MGI:2144529]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7966 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1905 Essential Splice Site F2 line generated During 2014
sa415 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030330 Essential Splice Site 47 566 None 12
ENSDART00000031028 Essential Splice Site 38 557 None 12
Genomic Location:
Chromosome 21 (position 31547263)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCGGCCAATGGAAAGAAGTCAACTTGGGCAGAGCTGGAGATTGTTGG[T/A]AAAGTTTGGGGGTTCTTTTTGGTGGGCCTGGTTTACTTTCTTCAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1905
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030330 Essential Splice Site 194 566 6 12
ENSDART00000031028 Essential Splice Site 185 557 6 12
Genomic Location:
Chromosome 21 (position 31539379)
KASP Assay ID:
554-1895.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTCGCTCATGGATACCACTGCAGGAGCCAGACAGAACACGGCCAGCAG[G/A]TGAGCAGGTTTCAYTTTAGCTCTGATTGTTACAGACTTTCGCTGCTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030330 Nonsense 491 566 11 12
ENSDART00000031028 Nonsense 482 557 11 12
Genomic Location:
Chromosome 21 (position 31533607)
KASP Assay ID:
554-0275.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAAACTGAAGAGTGCTTACGAGAACGGCCTGATGCCTTACACCAACTA[C/A]ACCTTTGACTTTAAGGTTTGACTTTTTTTTTTTTCATACAATACTTCTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x1t1hxk9